Isolation and Identification of Salmonella Species Associated with Febrile Patient Using Basic Molecular Techniques

Abstract

Salmonella enterica, serotype Typhi, remains the predominant Salmonella species causing enteric fever. This disease threatens public health as it is associated with personal hygiene techniques and practices. This study investigates Salmonella typhi using conventional bacteriological techniques as well as polymerase chain reaction (PCR). The results showed that of the four hundred and eighty-six (486) stool samples analyzed, stool cultures revealed 189 putative isolates. These isolates, after identification by conventional biochemical methods, showed 6 isolates (1.23%). The Six (6) confirmed strains were then confirmed PCR with the following set of primers. STR (F) TAT GCC GCT ACA TAT GAT GAG, STR (R) TTA ACG CAG TAA AGA GAG and STN (F) ACT GCT AAA ACC ACT ACT, STN (R) TGG AGA CTT CGG TCG CGT AG and aroC for GGCACCAGTATTGGCCTGCT and aroCs rev CATATGCGCCACAATGTGTTG. The results confirmed one (1) strain of S. typhi and two (2) related serovars (Salmonella typhimuirium). The isolates of Salmonella showed a high rate of antibiotic resistance to gentamicin (100%), augumentin (83.3%), cotrimoxazole (83.3%). In contrast, the isolates were very sensitive to nitrofurantoin (100%) and ofloxacin (83.3%). Others show a different resistance rate. This study confirms the need for multi-step diagnosis for enteric fever to provide appropriate and effective treatment. This finding will guide the use of antibiotics in the treatment of Salmonella infections in the study area and justify the search for new effective antibiotics against multi drug resistance.